View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4007_high_7 (Length: 342)
Name: NF4007_high_7
Description: NF4007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4007_high_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 133; Significance: 4e-69; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 9 - 164
Target Start/End: Original strand, 11168067 - 11168220
Alignment:
| Q |
9 |
attattctctcaaaaagagtttctgatattattggtgttcagccgaggggtttggtggcggtgccaataagtatgattgtactgctaggtgtgctgatct |
108 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
11168067 |
attattctctcaaaaaaagtttctgatattattgttgttcagccgaggggtttggtggcggtgccaataagtatgattgtactgctgggtgtgctgatct |
11168166 |
T |
|
| Q |
109 |
tatattagggatcagaagatgagtgattaggggattctttggatttttggagaaat |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11168167 |
--tattagggatcagaagatgagtgattaggggattctttggatttttggagaaat |
11168220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 220 - 322
Target Start/End: Original strand, 11168221 - 11168322
Alignment:
| Q |
220 |
acattcgataatttaattgtgacacataaattaattaaaatattttttctctctctcttttgcatgtttttatgcttnnnnnnnnttgtattgtcacata |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
11168221 |
acattcgataatttaattgtgacacataaatcaattaaaatatttttt-tctctctcttttgcatgtttttatgcttaaaaaaaattgtattgtcacata |
11168319 |
T |
|
| Q |
320 |
tca |
322 |
Q |
| |
|
||| |
|
|
| T |
11168320 |
tca |
11168322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University