View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4009_low_2 (Length: 494)
Name: NF4009_low_2
Description: NF4009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4009_low_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 310; Significance: 1e-174; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 149 - 476
Target Start/End: Complemental strand, 21484600 - 21484276
Alignment:
| Q |
149 |
acaccattgaaaaccattgcatgtacttcaactacaacaactactacctcttcttcttcctcagcttcttcttcatctgcagcttcttgggctgttttga |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21484600 |
acaccattgaaaaccattgcatgtacttcaactacaacaactactacctcttcttcttcctcagcttcttcttcatctgcagcttcttgggctgttttga |
21484501 |
T |
 |
| Q |
249 |
aatcagatgttgaagtagatcatcaaggttatcatcaaaaacatggtcatccattagattatcatcatggtcatcctccaacaactttgtcatcaactgc |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21484500 |
aatcagatgttgaagtagatcatcaaggttatca---aaaacatggtcatccattagattatcatcatggtcatcctccaacaactttgtcatcaactgc |
21484404 |
T |
 |
| Q |
349 |
ttctatggagatttctcagcaacagcaacaagatcttggtgtttctaacaatgatgttgttgttggtggtggtgattgcatggatgatgttaacattatg |
448 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21484403 |
ttctatggagatttctcaacaacagcaacaagatcttggtgtttctaacaatgatgttgttgttggtggtggtgattgcatggatgatgttaacattatg |
21484304 |
T |
 |
| Q |
449 |
gatacttttggttacatggagcttttag |
476 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
21484303 |
gatacttttggttacatggagcttttag |
21484276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 103; E-Value: 5e-51
Query Start/End: Original strand, 12 - 118
Target Start/End: Complemental strand, 21484737 - 21484631
Alignment:
| Q |
12 |
ataatactacaaatgatcaagatggtgatcttttaggtatgaatatgaatgatgatgcatctatgttctatgctgattttccacctttacctgattttcc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
21484737 |
ataatactacaaatgatcaagatggtgatcttttaggtatgaatatgaatgatgatgcatctatgttctatgctgattttcctcctttacctgattttcc |
21484638 |
T |
 |
| Q |
112 |
atgcatg |
118 |
Q |
| |
|
||||||| |
|
|
| T |
21484637 |
atgcatg |
21484631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University