View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4010_high_12 (Length: 306)
Name: NF4010_high_12
Description: NF4010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4010_high_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 134; Significance: 9e-70; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 134; E-Value: 9e-70
Query Start/End: Original strand, 87 - 296
Target Start/End: Original strand, 42711221 - 42711421
Alignment:
| Q |
87 |
acaatggagtttgttgtaggttctctagagtttattttcaaagttacccctaactttgatgtatcattttgaggttaaggacgcttttgagatgagggat |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42711221 |
acaatggagtttgttgtaggttctctagagtttattttc---------cctaactttgatgtatcattttgaggttaaggacgcttttgagatgaaggat |
42711311 |
T |
 |
| Q |
187 |
ggttctgagatgaata-caatattgagggtcaatgacgatannnnnnngcttgtatttgtatttggtttgtgcatttggccatcacctaatacaattcgg |
285 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42711312 |
ggttctgagatgaataccgatattgagggtcaatgacgat-gttttttgcttgtatttgtatttggtttgtgcatttggccatcacctaatacaattcgg |
42711410 |
T |
 |
| Q |
286 |
tatttcctatg |
296 |
Q |
| |
|
||||||||||| |
|
|
| T |
42711411 |
tatttcctatg |
42711421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University