View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4010_high_20 (Length: 240)
Name: NF4010_high_20
Description: NF4010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4010_high_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 3 - 144
Target Start/End: Complemental strand, 49187716 - 49187575
Alignment:
| Q |
3 |
taggcaaccaaataggagtataatcaactaatcaagaagctagttataagtacacttcnnnnnnnnnnnnnnnnnctaattataagtagtttcaaatcaa |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
49187716 |
taggcaaccaaataggagtataatcaactaatcaagaagctaattataagtacacttcaaaacaaaaacaaaaaactaattataaatagtttcaaatcaa |
49187617 |
T |
 |
| Q |
103 |
aattttgaattgattatgcatttgcactctaattttcaacta |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49187616 |
aattttgaattgattatgcatttgcactctaattttcaacta |
49187575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 200 - 240
Target Start/End: Complemental strand, 49187519 - 49187479
Alignment:
| Q |
200 |
aagtaatttttgagcttaccaggaagctgaaaccggtgaca |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49187519 |
aagtaatttttgagcttaccaggaagctgaaaccggtgaca |
49187479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University