View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4010_low_18 (Length: 254)
Name: NF4010_low_18
Description: NF4010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4010_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 135 - 244
Target Start/End: Original strand, 21525812 - 21525920
Alignment:
| Q |
135 |
cccataaaaatgcttgtcggagaaggaagatttgaaagaaagaaaatcgagtttcacaacaacacactagtacacgttgtaacaaatatacatagtaaaa |
234 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
21525812 |
cccataaaaatgct-gtcggagaaggaagggttgaaagaaagaaaatcgagtttcacaacaacacacaagtacacgttgtaacaaatatgcatagtaaaa |
21525910 |
T |
 |
| Q |
235 |
ggtaattcat |
244 |
Q |
| |
|
|||||||||| |
|
|
| T |
21525911 |
ggtaattcat |
21525920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 18 - 69
Target Start/End: Original strand, 21525695 - 21525746
Alignment:
| Q |
18 |
cattttccacatgataattttttatcaaaaatgtttgttgagtagtagctta |
69 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21525695 |
cattttccacatgataattttttatcaaaaatgtttgttgagtagtagctta |
21525746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University