View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4010_low_21 (Length: 243)
Name: NF4010_low_21
Description: NF4010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4010_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 43526803 - 43527020
Alignment:
| Q |
1 |
aaagggtcaataagttgacccggccggtttaatataacatccggttcgccgatttaatccggatcttgccggattaaactggtccataacgggttgataa |
100 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43526803 |
aaagggtcaataagatgagtcggccggtttaatataacatccggttcgccgatttaatccggatcttgccggattaaactggtccataacgggttgataa |
43526902 |
T |
 |
| Q |
101 |
cataaccgatctgatcactaaatggaaccggttaaccatccggtttccgattggactggttcgaccggctgatcaggtttttaaaaatatgcttcgagac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||| |||||||||||||||||||| |||| |
|
|
| T |
43526903 |
cataaccgatctgatcactaaatggaaccggttaaccatccggttcccgattggact---------ggctgatccggtttttaaaaatatgcttcaagac |
43526993 |
T |
 |
| Q |
201 |
tccatctattgtcttaattacttcatg |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
43526994 |
tccatctattgtcttaattacttcatg |
43527020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University