View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4010_low_24 (Length: 236)
Name: NF4010_low_24
Description: NF4010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4010_low_24 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 23 - 236
Target Start/End: Complemental strand, 5681793 - 5681580
Alignment:
| Q |
23 |
taattagagaattagtttcaagagcatcaactctagcaccaacttgtgtagcttttttccttattgaatcagccgacatattcccatgttgttgtagatt |
122 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5681793 |
taattagagaattagtttcaatagcatcaactctagcaccaacttgtgcagcttttttccttattgaatcagccgacatattcccatgttgttgtagatt |
5681694 |
T |
 |
| Q |
123 |
ttcttcatcttcttgttgatctttgaacaacaattcaggaaaattaaggtttgcagaaggacctctaagataaaacacagcagtatcataagcacgtgca |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5681693 |
ttcttcatcttcttgttgatctttgaacaacaattcaggaaaattaaggtttgcagaaggacctctaagataaaacacagcagtatcataagcacgtgca |
5681594 |
T |
 |
| Q |
223 |
gcagcaataggtgt |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
5681593 |
gcagcaataggtgt |
5681580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 42 - 101
Target Start/End: Original strand, 47038233 - 47038292
Alignment:
| Q |
42 |
aagagcatcaactctagcaccaacttgtgtagcttttttccttattgaatcagccgacat |
101 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||| | |||| ||||||| ||||| |
|
|
| T |
47038233 |
aagagcatcaactctagcaccgactttggtagcttttttgcgtattaaatcagcagacat |
47038292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University