View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4010_low_26 (Length: 234)
Name: NF4010_low_26
Description: NF4010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4010_low_26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 18 - 221
Target Start/End: Original strand, 31446038 - 31446241
Alignment:
| Q |
18 |
tttccccttaaaaattactctattcctggaagaccgaagatcccacacacatgaatgcaataaatcgtgctgtagaaaatgtgaaacaggctcgacatta |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31446038 |
tttccccttaaaaattactctattcctggaagaccgaagatcccacacacatgaatgcaataaatcgtgctgtagaaaatgtgaaacaggctcgatatta |
31446137 |
T |
|
| Q |
118 |
caaatctcattcaaaggaccggatatacaattattagaaatgtatatctattatctatgtttccgtaaacttaatttaattgataggatattgcatgaaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |||||| |||||| |
|
|
| T |
31446138 |
caaatctcattcaaaggaccggatatacaattattagaaatgtatatctattatctatgtctccgtaaacttaatttaattgacagaatattgtatgaaa |
31446237 |
T |
|
| Q |
218 |
tatg |
221 |
Q |
| |
|
|||| |
|
|
| T |
31446238 |
tatg |
31446241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University