View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4011_high_4 (Length: 496)
Name: NF4011_high_4
Description: NF4011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4011_high_4 |
 | |
|
| [»] scaffold0194 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0194 (Bit Score: 148; Significance: 7e-78; HSPs: 2)
Name: scaffold0194
Description:
Target: scaffold0194; HSP #1
Raw Score: 148; E-Value: 7e-78
Query Start/End: Original strand, 214 - 479
Target Start/End: Complemental strand, 19719 - 19470
Alignment:
| Q |
214 |
ttcatttatattcaattcaatcagataatcttannnnnnnnnnnnttgtagagcataccttgagagtgtggcagagagtgagaaaatcgatagcagaaga |
313 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19719 |
ttcatttatattcaattcaaccagataatctta----gtgtgtgtttgtagagcataccttgagagtgtggcagagagtgagaaaatcgatagcagaaga |
19624 |
T |
|
| Q |
314 |
agaagaagaggaggtgtgagaaggttcatgtttctgggtctgggaacgaaccaaaacgagcggagcgtagttgcggagaacatgaatcgaccgcc---ga |
410 |
Q |
| |
|
||| ||| |||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
19623 |
aga---------------agagggttcatgtttctgagtatgggaacgaaccaaaacgagcggagcgtagttgcggagaacatgaatcgaccgccgatga |
19539 |
T |
|
| Q |
411 |
tgatgatgatgatgcagtggtgacatacaataataccgactgcttgcgtaattattaatcgccattttt |
479 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19538 |
tgatgatgatgatgcagtggtgacatacaataataccgactgcttgcgtaattattaatcgccattttt |
19470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0194; HSP #2
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 47 - 180
Target Start/End: Complemental strand, 19876 - 19743
Alignment:
| Q |
47 |
cagtgaacctttctctactcaatccaggaacatcagaaacaataagtgacatcaaagccatacggtacatatggtcagctatggattcagctccttttat |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19876 |
cagtgaacctttctctactcaatccaggaacatgagaagcaatgagtgacatcaaagccatacggtacatatggtcagctatggattcagctccttttat |
19777 |
T |
|
| Q |
147 |
cccatgattaacccatcctttcctctttgtggtc |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
19776 |
cccatgattaacccatcctttcctctttgtggtc |
19743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University