View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4011_low_12 (Length: 390)
Name: NF4011_low_12
Description: NF4011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4011_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 363; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 363; E-Value: 0
Query Start/End: Original strand, 11 - 377
Target Start/End: Complemental strand, 857015 - 856649
Alignment:
| Q |
11 |
caaaggcattggattctggtttggatgtgcctcatgactgcaagcttggagtttgcatgacttgtcctgctcgtcttatcagcggcacagttgatcagag |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
857015 |
caaaggcattggattctggtttggatgtgcctcatgactgcaagcttggagtttgcatgacttgtcctgctcgtcttatcagcggcacagttgatcagag |
856916 |
T |
 |
| Q |
111 |
tgatggaatgctcagtgatgatgttgtggagcgtggttatgcactcttgtgtgcctcttatcctcgttctgattgtcatattagggttatcccagaggat |
210 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
856915 |
tgatggtatgctcagtgatgatgttgtggagcgtggttatgcactcttgtgtgcctcttatcctcgttctgattgtcatattagggttatcccagaggat |
856816 |
T |
 |
| Q |
211 |
gagctgctttcgatgcagctagccacagccaatgactaaatctagttttcagttttgaatgtaattctcacctgtcaatggaattgagtctttgcttgtt |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
856815 |
gagctgctttcgatgcagctagccacagccaatgactaaatctagttttcagttttgaatgtaattctcacctgtcaatggaattgagtctttgcttgtt |
856716 |
T |
 |
| Q |
311 |
tcttatgataatgataattcatactgtttctctgttctgctaagttaatttcatttatgtagatttt |
377 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
856715 |
tcttatgataatgataattcatactgtttctctgttctgctaagttaatttcatttatgtagatttt |
856649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University