View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4011_low_24 (Length: 234)
Name: NF4011_low_24
Description: NF4011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4011_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 16 - 216
Target Start/End: Complemental strand, 29423361 - 29423162
Alignment:
| Q |
16 |
tgagaagaattaagtacgtatggggtataaagtttcggttagtagtacaaatattgcctaattaatcaataaatttctaagaaaaatattttttctacta |
115 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29423361 |
tgagaagaattcagtacgtatggg-tataaagttttggttcatagtacaaatattgcctaattaatcaataaatttctaagaaaaatattttttctacta |
29423263 |
T |
 |
| Q |
116 |
cacaaaacagtaacatggataaattatgaagagagagaggagggggagaggtattgtcttgggtatggtcataaagtactttctgttttagctttggtct |
215 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29423262 |
cactaaacagtaacatggataaattatgaagagagagaggagggtgagaggtattatcttgggtatggtcataaagtactttctgttttagctttggtct |
29423163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 57 - 117
Target Start/End: Original strand, 13574225 - 13574285
Alignment:
| Q |
57 |
gtagtacaaatattgcctaattaatcaataaatttctaagaaaaatattttttctactaca |
117 |
Q |
| |
|
||||||| ||||| || ||||||| ||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
13574225 |
gtagtacttatattaccaaattaattaataaatttttaagaaaaacattttttctactaca |
13574285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University