View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4012_high_13 (Length: 477)
Name: NF4012_high_13
Description: NF4012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4012_high_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 445; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 445; E-Value: 0
Query Start/End: Original strand, 14 - 458
Target Start/End: Original strand, 36467698 - 36468142
Alignment:
| Q |
14 |
cacagaggatgaagctacggagttttatgtattgtttgcaaaataccacgggtttgaagtaagaaaggatgatgtgaaacgttattctaatgggaacatt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36467698 |
cacagaggatgaagctacggagttttatgtattgtttgcaaaataccacgggtttgaagtaagaaaggatgatgtgaaacgttattctaatgggaacatt |
36467797 |
T |
|
| Q |
114 |
attatgcgtcaattagtatgcaaaaagaagaatgcattgtaactatttggatgtctgctgtatggttatgtggattggttgtgtgcgttttctacttgga |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36467798 |
attatgcgtcaattagtatgcaaaaagaagaatgcattgtaactatttggatgtctgctgtatggttatgtggattggttgtgtgcgttttctacttgga |
36467897 |
T |
|
| Q |
214 |
tctgtggtctggctctgcgcgatttgctgatgctgtcttctggtttttgcgggtgtaggctgtgcagtttttccagtctgctgcatgttcggttttggcg |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36467898 |
tctgtggtctggctctgcgcgatttgctgatgctgtcttctggtttttgcgggtgtaggctgtgcagtttttccagtctgctgcatgttcggttttggcg |
36467997 |
T |
|
| Q |
314 |
tgacagtatgctagggactttttctttggttcacaatcatagttaggagtgattggccttggcattgtgctgttagaggtctttagtgccataagggtaa |
413 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36467998 |
tgacagtatgctagggactttttctttggttcacaatcatagttaggagtgattggccttggcattgtgctgttagaggtctttagtgccataagggtaa |
36468097 |
T |
|
| Q |
414 |
agggattaaggttccacttttacatacggagttttttggcgttcc |
458 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36468098 |
agggattaaggttccacttttacatacggagttttttggcgttcc |
36468142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University