View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4012_high_36 (Length: 310)
Name: NF4012_high_36
Description: NF4012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4012_high_36 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 279; Significance: 1e-156; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 1 - 291
Target Start/End: Original strand, 14177620 - 14177910
Alignment:
| Q |
1 |
atgttgagccatcaaaaatgactctgtacagatttggaaacacttcatcttcttcaatttggtatgagttgtcatatattgaagcaaaagggaggatgaa |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14177620 |
atgttgaaccatcaaaaatgactctgtacagatttggaaacacttcatcttcttcaatttggtatgagttgtcatacattgaagcaaaagggaggatgaa |
14177719 |
T |
 |
| Q |
101 |
atgtggagatagggtgtggcaaattgcctttggaagtggattcaagtgtaacagtgcagtgtggaagtgtttaggtgacgtgaagcctgataccaccact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
14177720 |
atgtggagatagggtgtggcaaattgcctttggaagtggattcaagtgtaacagtgcagtgtggaaatgtttaggtgacgtgaagcctgataccaccact |
14177819 |
T |
 |
| Q |
201 |
gcgtggagagacactattcactcatacccagtagatattttgggaacaaactgatacaaagtatgaacattgtgttgtgcttgatctttgt |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14177820 |
gcgtggagagacactattcactcatacccagtagatattttgggaacaaactgatacaaagtatgaacattgtgttgtgcttgatctttgt |
14177910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 117 - 169
Target Start/End: Original strand, 794325 - 794377
Alignment:
| Q |
117 |
tggcaaattgcctttggaagtggattcaagtgtaacagtgcagtgtggaagtg |
169 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||||||| || |||||||| |
|
|
| T |
794325 |
tggcaaattggctttggaagtggtttcaagtgtaacagtgctgtctggaagtg |
794377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 75 - 166
Target Start/End: Complemental strand, 23271461 - 23271370
Alignment:
| Q |
75 |
tatattgaagcaaaagggaggatgaaatgtggagatagggtgtggcaaattgcctttggaagtggattcaagtgtaacagtgcagtgtggaa |
166 |
Q |
| |
|
||||||||| ||||||| |||||||| | || ||||| || |||||||| || |||||||||||||| || || || ||||| |||||||| |
|
|
| T |
23271461 |
tatattgaatcaaaaggaaggatgaagagaggtgatagagtatggcaaatagcttttggaagtggatttaaatgcaatagtgctgtgtggaa |
23271370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 137 - 167
Target Start/End: Original strand, 46572880 - 46572910
Alignment:
| Q |
137 |
tggattcaagtgtaacagtgcagtgtggaag |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
46572880 |
tggattcaagtgtaacagtgcagtgtggaag |
46572910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University