View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4012_high_47 (Length: 250)
Name: NF4012_high_47
Description: NF4012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4012_high_47 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 33871915 - 33872157
Alignment:
| Q |
1 |
ataaggactttgtttccaatgcaacatcggacaacactttgacggtaagcgtcggtcctgatacgatggcagacattacaaatgcaactatgaatggatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33871915 |
ataaggactttgtttccaatgcaacatcggacaacactttgacggtaagcgtcggtcctgatacgatggcagacattacaaatgcaactatgaatggatt |
33872014 |
T |
 |
| Q |
101 |
ggagataatgaaaatcagcaatgcattgaagagcttggatggactttcgtcggtcaagagtttgcttcccagttcaaaatcaaaaaagaacaagatagga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33872015 |
ggagataatgaaaatcagcaatgcattgaagagcttggatggactttcgtcggtcaagagtttgcttcccagttcaaaatcaaaaaagaacaagatagga |
33872114 |
T |
 |
| Q |
201 |
atcatcattggctctgctgctggtgctgttgttgcctttgctt |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33872115 |
atcatcattggctctgctgctggtgctgttgttgcctttgctt |
33872157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University