View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4012_low_27 (Length: 361)
Name: NF4012_low_27
Description: NF4012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4012_low_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 254; Significance: 1e-141; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 84 - 353
Target Start/End: Original strand, 4759684 - 4759953
Alignment:
| Q |
84 |
cttacatgtaagttccatcagctaggtaaatcaacgccgttaaccctgctctccggtgactaaccacctgcgacgccaccatagataccaaaaccggcac |
183 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4759684 |
cttacgtgtaagttccatcagctaggtaaatcaacgccgtcaaccctgctctccggtgactaaccacctgtgacgccaccatagataccaaaaccggcac |
4759783 |
T |
 |
| Q |
184 |
cactccaagttctgttatcaactttctaaccttaacatcttctttaactaaactttcaatctcttttgcagctatctccttctcttcccagcttccaaag |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4759784 |
cactccaagttctgttatcaactttctaaccttaacatcttctttaactaaactttcaatctcttttgcagctatctccttctcttcccagcttccaaag |
4759883 |
T |
 |
| Q |
284 |
tgaagcatcttcactgtcttttgcagcaaaatttcagtttcttccaccacctcctcctcctccctatgct |
353 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4759884 |
tgaagcatcttcactgtcttttgcagcaaaatttcagtttcttccaccacctcctcctcctccttatgct |
4759953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 18 - 74
Target Start/End: Original strand, 4759602 - 4759655
Alignment:
| Q |
18 |
attgtgacatgagtttgaacctggtggtgcgtgaaattcgctgttaggctgcttgat |
74 |
Q |
| |
|
||||||| | ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4759602 |
attgtgagacgagtttgaacctggt---gcgtgaaattcgctgttaggctgcttgat |
4759655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 4e-17; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 168 - 297
Target Start/End: Original strand, 26982154 - 26982283
Alignment:
| Q |
168 |
ataccaaaaccggcaccactccaagttctgttatcaactttctaaccttaacatcttctttaactaaactttcaatctcttttgcagctatctccttctc |
267 |
Q |
| |
|
||||||| || |||||||| | |||||| || ||||||||||| ||||||||||||| |||| | | | ||||| |||||||| ||| ||| ||||| |
|
|
| T |
26982154 |
ataccaatacaggcaccacccgaagttcagtcatcaactttctgaccttaacatcttgtttagccagcatctcaatatcttttgctgcttcctctttctc |
26982253 |
T |
 |
| Q |
268 |
ttcccagcttccaaagtgaagcatcttcac |
297 |
Q |
| |
|
||||||||| |||||||||||| ||||||| |
|
|
| T |
26982254 |
ttcccagctcccaaagtgaagcttcttcac |
26982283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 245 - 297
Target Start/End: Complemental strand, 26999187 - 26999135
Alignment:
| Q |
245 |
tcttttgcagctatctccttctcttcccagcttccaaagtgaagcatcttcac |
297 |
Q |
| |
|
|||||||| ||| ||| |||||||||||||| |||||||||||| ||||||| |
|
|
| T |
26999187 |
tcttttgctgcttcctctttctcttcccagctcccaaagtgaagcttcttcac |
26999135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University