View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4012_low_42 (Length: 266)
Name: NF4012_low_42
Description: NF4012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4012_low_42 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 17 - 248
Target Start/End: Original strand, 27679 - 27910
Alignment:
| Q |
17 |
atgtaaataacctctacctaggcagagggaattggagacactatttgccgtgaaagaaattcagagtcaaaactcaaaactgatcaccagggatttaaag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27679 |
atgtaaataacctctacctaggcagagggaattggagacactatttgccgtgaaagaaattcagagtcaaaactcaaaactgatcaccagggatttaaag |
27778 |
T |
|
| Q |
117 |
aattgatgtttagatagatgttaaaaatccgtgagtgtgtatactattatctaaccaaattgcttcactatgattctggcacaatattcagccctagtaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27779 |
aattgatgtttagatagatgttaaaaatccgtgagtgtgtatactattatctaaccaaattgcttcactatgattctggcacaatattcagccctagtaa |
27878 |
T |
|
| Q |
217 |
gtaaaaacatggtatctgactaacgccttctc |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
27879 |
gtaaaaacatggtatctgactaacgccttctc |
27910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University