View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4012_low_46 (Length: 254)
Name: NF4012_low_46
Description: NF4012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4012_low_46 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 247
Target Start/End: Original strand, 10251463 - 10251715
Alignment:
| Q |
1 |
catgtgttagtgtcaatgcccgaatttggaaactaaaattccaaacctgaaatgtaaacgttctaatcttgatctaaccaacaaccaaagatattaatgc |
100 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10251463 |
catgtgtcagtgtcaatgtccgaatttggaaactaaaattccaaacctgatatctaaacgttctaatcttgatctaaccaacaaccgaagatattaatga |
10251562 |
T |
|
| Q |
101 |
aatcatccgaattcctcttaggttatatatgccaactagtcgatg------tgtttctaatattctggcaggttgatttggttagcaacataggtttggt |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10251563 |
aatcatccgaattcctcttaggttatatatgccaactagtcgatgctcccatgtttctaatattctggcaggttgatttggttagcaacataggtttggt |
10251662 |
T |
|
| Q |
195 |
tggtcatgtttcgtttggcgatgttctattgcctctaatttattcctatgcta |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10251663 |
tggtcatgtttcgtttggcgatgttctattgcctctaatttattcctatgcta |
10251715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University