View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4012_low_53 (Length: 238)
Name: NF4012_low_53
Description: NF4012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4012_low_53 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 30770023 - 30769803
Alignment:
| Q |
1 |
ctcttagtcttgatgatgaaggtttcatggtagaagatgcagatgctatacgatcatattcttcaatcatgttatcaagatcttcatctgatgttactgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30770023 |
ctcttagtcttgatgatgaaggtttcattgtagaagatgccgatgctatacgatcatattcttcaatcatgttatcaagatcttcatctgatgttactgt |
30769924 |
T |
 |
| Q |
101 |
aatgaggttatcaaggtcttcattaggaagctggtacttgagagtaaagggtcttccattgagaattgttctcgaaaggcgtgaacataggtctctcaga |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
30769923 |
aatgaggttatcaaggtcttcatttggaagctggtacttgagagtaaagggtcttccattgagaattgttctcgaaagacgcgaacataggtctctcaga |
30769824 |
T |
 |
| Q |
201 |
gaagaactgcgatccacgacc |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
30769823 |
gaagaactgcgatccacgacc |
30769803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 102 - 156
Target Start/End: Original strand, 44884380 - 44884434
Alignment:
| Q |
102 |
atgaggttatcaaggtcttcattaggaagctggtacttgagagtaaagggtcttc |
156 |
Q |
| |
|
|||||||| |||||||||||||| ||||| |||||||||||||| || ||||||| |
|
|
| T |
44884380 |
atgaggttgtcaaggtcttcattgggaagatggtacttgagagtgaaaggtcttc |
44884434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University