View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4013_high_7 (Length: 419)
Name: NF4013_high_7
Description: NF4013
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4013_high_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 106; Significance: 7e-53; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 106; E-Value: 7e-53
Query Start/End: Original strand, 9 - 170
Target Start/End: Complemental strand, 14464612 - 14464451
Alignment:
| Q |
9 |
agcagagactttaaaatttatgtttatt-attcttgacagccatggtgtttaatattgggtgaatgatggtgttggtataatgaaggatggagtaaatct |
107 |
Q |
| |
|
|||||||||||| |||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
14464612 |
agcagagactttcaaatttatgtttttttattcttgacagccatggtgtttaatattgggtgaatgatggtgttggtatgatgaaggatggagtaaatct |
14464513 |
T |
|
| Q |
108 |
atttgaagtaaagagatgnnnnnnntagaattgtgtcgattccaatgccaacgagaaagaaga |
170 |
Q |
| |
|
|||||||||| ||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
14464512 |
atttgaagtagagagatgaaagaag-ataattgtgtcgattccaatgccaacgagaaagaaga |
14464451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University