View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4013_low_4 (Length: 476)
Name: NF4013_low_4
Description: NF4013
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4013_low_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 299; Significance: 1e-168; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 86 - 460
Target Start/End: Complemental strand, 11471907 - 11471534
Alignment:
| Q |
86 |
gagtcttgtaattgttatttggtgcattcttacttttactctcaatcattttcgagtgtttccataagatgcttctggagtattatgtatttcattgtcc |
185 |
Q |
| |
|
|||||||||||||||| ||| ||||||| ||||||| | |||||||||||| | |||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
11471907 |
gagtcttgtaattgttttttagtgcattattactttctcactcaatcattttagtgtgtttccataagatgcttctggagtattatgtatttcatactcc |
11471808 |
T |
|
| Q |
186 |
atttttgttttggtattttcctttactatcgtcattttcattagatccataagatctatcttcttttttagatgtcattaattaaattcaagaggtgata |
285 |
Q |
| |
|
|| || |||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
11471807 |
atagttattttggtattttcctttactat-gtcattttcattagatccataaaatctatcttcttttttacatgtcattaattaatttcaagaggtgata |
11471709 |
T |
|
| Q |
286 |
atctgaatgatgtatttaataatttgatccaattcatgatttgtctgattataacagctggggcatcctagttcttgataaaggggacaccatctcttat |
385 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11471708 |
atctgaatgatgtatttaataatttgatccaattcatgatttgtctgattataacagctgggacatcctagttcttgataaaggggacaccatctcttat |
11471609 |
T |
|
| Q |
386 |
gattgacaaacaagtcaatagaattttcttggaccttatcttcatcattctaacataaaattttggttaagacat |
460 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11471608 |
gattgacaaacaagtcaatagaattttcttggaccttatcttcatcattctaacataaaattttggttaagacat |
11471534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 5233659 - 5233616
Alignment:
| Q |
1 |
tatgtgattttctcaaattattaatggtatcagtgtgtcagtgt |
44 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
5233659 |
tatgtgattttctcaaattattaaccgtatcggtgtgtcagtgt |
5233616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 7 - 36
Target Start/End: Original strand, 26993594 - 26993623
Alignment:
| Q |
7 |
attttctcaaattattaatggtatcagtgt |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
26993594 |
attttctcaaattattaatggtatcagtgt |
26993623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.00000001; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 1074828 - 1074785
Alignment:
| Q |
1 |
tatgtgattttctcaaattattaatggtatcagtgtgtcagtgt |
44 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||| |||| |
|
|
| T |
1074828 |
tatgtgattttctcaaattattagtggtgtcagtgtgtccgtgt |
1074785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 5775387 - 5775427
Alignment:
| Q |
1 |
tatgtgattttctcaaattattaatggtatcagtgtgtcagt |
42 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
5775387 |
tatgtgattttctcaaattattaatggtgtc-gtgtgtcagt |
5775427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 26290401 - 26290358
Alignment:
| Q |
1 |
tatgtgattttctcaaattattaatggtatcagtgtgtcagtgt |
44 |
Q |
| |
|
|||||||||||||||||||||||||||| || | |||||||||| |
|
|
| T |
26290401 |
tatgtgattttctcaaattattaatggtgtcggcgtgtcagtgt |
26290358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.00000001; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 10572618 - 10572665
Alignment:
| Q |
1 |
tatgtgattttctcaaattattaatggtatcagtgtgtcagtgttcat |
48 |
Q |
| |
|
||||||||||||||||||||||| |||| || | |||||||||||||| |
|
|
| T |
10572618 |
tatgtgattttctcaaattattagtggtgtcggcgtgtcagtgttcat |
10572665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 34298466 - 34298425
Alignment:
| Q |
1 |
tatgtgattttctcaaattattaatggtatcagtgtgtcagt |
42 |
Q |
| |
|
||||||||||||||||||||||| |||| || |||||||||| |
|
|
| T |
34298466 |
tatgtgattttctcaaattattagtggtgtcggtgtgtcagt |
34298425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 27471595 - 27471639
Alignment:
| Q |
1 |
tatgtgattttctcaaattattaatggtatcagtgtgtcagtgtt |
45 |
Q |
| |
|
|||||| |||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
27471595 |
tatgtgcttttctcaaattattagcggtatcggtgtgtcagtgtt |
27471639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 35017067 - 35017018
Alignment:
| Q |
1 |
tatgtgattttctcaaattattaatggtatcagtgtgtcagtgttcatat |
50 |
Q |
| |
|
||||||||||||||||||||||| |||| || | ||||| |||||||||| |
|
|
| T |
35017067 |
tatgtgattttctcaaattattagtggtttcggcgtgtcggtgttcatat |
35017018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University