View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4014_high_26 (Length: 336)
Name: NF4014_high_26
Description: NF4014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4014_high_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 19 - 326
Target Start/End: Complemental strand, 37632935 - 37632627
Alignment:
| Q |
19 |
gtttgagtcctagggtgttcatggttgttttgaggttcatgtattcgtgggttagcaacatgtttttggtctgtatggctactctctggcaggcaatttt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
37632935 |
gtttgagtcctagggtgttcatggttgttttgaggttcatgtattcgtgggttagcaacatgtttttggtttgtatggctactctctggcaggcaatttt |
37632836 |
T |
|
| Q |
119 |
tgggttatctttgtatgccttgtcattggtgtatgactttgtatggtgtattgtc-ccccttcgagcacatatagtggaagccttttccaacccttcata |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
37632835 |
ggggttatctttgtatgccttgtcattggtgtatgactgtgtatggtgtattgtccccccttcgagcacatatagtgtaagccctttccaacccttcata |
37632736 |
T |
|
| Q |
218 |
gaaggtgggtagaggtatcttgttgtgatgcttgcggcagagtttttaatattttaattcatcgagaaaaacaacaaaaatgaagaagtatgaattgcat |
317 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
37632735 |
gaaggtgggtagagttatcttgttatgatgcttgcggcagagtttttaatattttaattcatcgagaaaaacaacaaaaatgcagaagtatgaattgcat |
37632636 |
T |
|
| Q |
318 |
gtagaataa |
326 |
Q |
| |
|
||||||||| |
|
|
| T |
37632635 |
gtagaataa |
37632627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 66; Significance: 4e-29; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 19 - 188
Target Start/End: Complemental strand, 28697502 - 28697333
Alignment:
| Q |
19 |
gtttgagtcctagggtgttcatggttgttttgaggttcatgtattcgtgggttagcaacatgtttttggtctgtatggctactctctggcaggcaatttt |
118 |
Q |
| |
|
|||||||||||| ||||| | |||||||||| |||||| |||||| ||| |||||||| |||||||||||||||| || |||| |||| || ||| | |
|
|
| T |
28697502 |
gtttgagtcctatggtgtccgtggttgttttaaggttcttgtattggtgaattagcaacctgtttttggtctgtatagcatctctttggcgggtaatatc |
28697403 |
T |
|
| Q |
119 |
tgggttatctttgtatgccttgtcattggtgtatgactttgtatggtgtattgtcccccttcgagcacat |
188 |
Q |
| |
|
| ||||||||||||||||||| |||||||||||| ||||||||| | |||||| | ||||||| ||||| |
|
|
| T |
28697402 |
ggtgttatctttgtatgccttgccattggtgtatgtctttgtatgatctattgtacaccttcgaacacat |
28697333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 19 - 176
Target Start/End: Complemental strand, 45220657 - 45220501
Alignment:
| Q |
19 |
gtttgagtcctagggtgttcatggttgttttgaggttcatgtattcgtgggttagcaacatgtttttggtctgtatggctactctctggcaggcaatttt |
118 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||| ||| ||||||||| |||||||||| |||||||| ||| ||| ||| |||||| |
|
|
| T |
45220657 |
gtttgagtcctagggtgtccatggttgttttatggttcatgtattggtgagttagcaacctgtttttggtttgtatggcatgtctttggtaggaaatttt |
45220558 |
T |
|
| Q |
119 |
tgggttatctttgtatgccttgtcattggtgtatgactttgtatggtgtattgtcccc |
176 |
Q |
| |
|
| ||| | |||| |||| ||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
45220557 |
ggtgttttatttgctcagcttgccattggt-tatgactttgtgtggtgtattgtcccc |
45220501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University