View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4014_high_40 (Length: 304)
Name: NF4014_high_40
Description: NF4014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4014_high_40 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 18 - 298
Target Start/End: Original strand, 30757405 - 30757685
Alignment:
| Q |
18 |
agaagtaacagggggttcagcatgacttgttggatgatcattagcaacaatgagctcttcggtattaatcagctcaccatgaagcttttcctgaatattt |
117 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30757405 |
agaagtaacagggggttcaacatgacttgttggatgatcattagtaacgatgagctcttcggtattaatcagctcaccatgaagcttttcctgaatattt |
30757504 |
T |
 |
| Q |
118 |
gaagtgtcatcagtaccgaatgaaattgtggcagggatatgctcttcattcacaatggcaataaccgccttattagtaattggtgctgcaaaagctttag |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
30757505 |
gaagtgtcatcagtaccgaatgaaattgtggcagggatatgctcttcattcacaatggcaataaccgccttattagtaattggcgctgcaaaagctttag |
30757604 |
T |
 |
| Q |
218 |
aagaacctataccatcaggatctttcttttcaacatatttcagagtcatttgcttccgagcatgtgtaggtttcttctcac |
298 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30757605 |
aagaacctataccatcatgatcgttcttttcaacatatttcagagtcatttgcttccgagcatgtgtaggtttcttctcac |
30757685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University