View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4014_high_46 (Length: 293)
Name: NF4014_high_46
Description: NF4014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4014_high_46 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 16 - 283
Target Start/End: Complemental strand, 28090437 - 28090166
Alignment:
| Q |
16 |
aaaatcactgttttgcaatagcaatatactatcctttatcgactctttgaagagtaagactggtttggtgcttcactaagcacatgnnnnnnnng---gt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
28090437 |
aaaatcactgttttgcaatagcaatatactatcctttatcgactctttgaagagtaagactggtttggtgcttcactaagcacatgttttttttttttgt |
28090338 |
T |
 |
| Q |
113 |
tgaaacttgtccaaagttaaagtacattcttattactgtaatgggattcagtgnnnnnnnn-aatcaaattaatacttctgacttaatccaaaaaattgt |
211 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28090337 |
tgaaacttgtccaaagttaaagcacattcttattactgtaatgggattcagtgtttttatttaatcaaattaatacttccgacttaatccaaaaaattgt |
28090238 |
T |
 |
| Q |
212 |
gtggaaggatggttcttttgggtcacatggatgttggattgagatattcctgttttttgtttaacttttctt |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
28090237 |
gtggaaggatggttcttttgggtcacatggatgttggattgagatattcctgttatttgtttaacttttctt |
28090166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University