View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4014_high_54 (Length: 255)
Name: NF4014_high_54
Description: NF4014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4014_high_54 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 61 - 237
Target Start/End: Original strand, 24513506 - 24513682
Alignment:
| Q |
61 |
gttattttgtatatttttagtttagattaatgtctttgttaattgtctaactacacttaatgtttctcgtagtttttgcgttgtttcaatgaatattgtg |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24513506 |
gttattttgtatatttttagtttagattaatgttcttgttaatggtctaactacacttgatgcttctcgtagtttttgcgttgtttcaatgaatattgtg |
24513605 |
T |
 |
| Q |
161 |
cacctcttgcacaatttatgtctctaatgttatgttatgtctctcaggtaactatcccatttgaagatagacatgat |
237 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24513606 |
cacctcttgcaaaatttatgtctctaatgttatgttatgtctctcaggtaactatcccatttgaagatagacatgat |
24513682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 74 - 198
Target Start/End: Original strand, 24505531 - 24505656
Alignment:
| Q |
74 |
tttttagtttagattaatgtctttgttaattgtctaactacacttaatgtttctcgtagtttttgcgttgt-ttcaatgaatattgtgcacctcttgcac |
172 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||| |||||||| || | ||||| |||||| ||| |||| || ||||||||| ||||| ||||||||| |
|
|
| T |
24505531 |
tttttaatttatattaatgtctttgttaattgtttaactacatgtatcgcttctcatagtttctgcattgtgtttaatgaatatcgtgcaactcttgcac |
24505630 |
T |
 |
| Q |
173 |
aatttatgtctctaatgttatgttat |
198 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
24505631 |
aatttatgtctctaatgttatgttat |
24505656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University