View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4014_high_64 (Length: 247)
Name: NF4014_high_64
Description: NF4014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4014_high_64 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 14 - 229
Target Start/End: Original strand, 6854808 - 6855026
Alignment:
| Q |
14 |
gaaaccaataagttcaccttcagaatctgcactgtcttcaataagcaacaaagatgagcatgacacgtccatatcattcatttctttatgaaaatgaaaa |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
6854808 |
gaaaccaataagttcaccttcagaatctgcactgtcttcaataagcaacaaagatgagcatgatacatccatatcattcatttctttatgaaaatgaaaa |
6854907 |
T |
 |
| Q |
114 |
acaaaataaacttg---tgaattctacatagagaatcttttgcaaagggatcgaataaagagtgctagtgaggtgtcattatataattaataattgtgaa |
210 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6854908 |
acaaaataaacttgtgatgaattctacatagagaatcttttgcaaagggatcgaataaagagtgctagtgaggtgtcattatataattaataattgtgaa |
6855007 |
T |
 |
| Q |
211 |
ggttggagtggtcctgttt |
229 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
6855008 |
ggttggagtggtcctgttt |
6855026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 18 - 96
Target Start/End: Original strand, 6861591 - 6861669
Alignment:
| Q |
18 |
ccaataagttcaccttcagaatctgcactgtcttcaataagcaacaaagatgagcatgacacgtccatatcattcattt |
96 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||||||||| | |||||| ||||| || |||||||||||||||| |
|
|
| T |
6861591 |
ccaataaggtcaccttcagaatctgcactgtcctcaataagcaatagagatgaacatgatacatccatatcattcattt |
6861669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University