View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4014_high_72 (Length: 239)
Name: NF4014_high_72
Description: NF4014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4014_high_72 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 19 - 239
Target Start/End: Complemental strand, 26846253 - 26846033
Alignment:
| Q |
19 |
cagatatcacagagaggagtgtctttggaagtggggtggtgaagagtgaagcgtttgtgtttagcagagaccttgttggcatagtggatattgcgatcac |
118 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26846253 |
cagatatcacagagaggggtgtctttggaagtggggtggtgaagagtgaagcgtttgtgtttagcagagaccttgttggcatagtggatattgcgatcac |
26846154 |
T |
|
| Q |
119 |
attgattgcagagagctgcttcatctgcagggcaaaacaaggaggcctcttgtttgtgacatgcatcacactggatcttcatctccttacttttgagcgt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26846153 |
attgattgcagagagctgcttcatctgcagggcaaaacaaggaggcctcttgtttgtgacatgcatcacactggatcttcatctccttacttttgagcgt |
26846054 |
T |
|
| Q |
219 |
tttggagatttgggttttgtt |
239 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
26846053 |
tttggagatttgggttttgtt |
26846033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University