View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4014_low_16 (Length: 420)
Name: NF4014_low_16
Description: NF4014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4014_low_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 364; Significance: 0; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 364; E-Value: 0
Query Start/End: Original strand, 15 - 394
Target Start/End: Original strand, 41367299 - 41367678
Alignment:
| Q |
15 |
tacattgtttttaatagattaacatatttataatcgtttagttattcatttttcaggttccatttagcatcatatcattcaccaaggcaaaaatctgcta |
114 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41367299 |
tacattgtttttaatagattaatatatttatattcatttagttattcatttttcaggttccatttagcatcatatcattcaccaaggcaaaaatctgcta |
41367398 |
T |
|
| Q |
115 |
acatggaggtactggttgtgcttggaatgaaaacttggtatcagaggaacacaacagatattgcactttcagatatatactgataagggagctttcttct |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41367399 |
acatggaggtactggttgtgcttggaatgaaaacttggtatcagaggaacacaacagatattgcactttcagatatatactgataagggagctttcttct |
41367498 |
T |
|
| Q |
215 |
aattaaacacatcaagagggagagtgcctttctcccttctaattcaaaatcaagtagcagctgatcatatgtcactttcccccgtttcccgtcaattagg |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41367499 |
aattaaacacatcaagagggagagtgcctttcttccttctaattcaaaatcaagtagcagctgatcatatgtcactttcccccgtttcccgtcaattagg |
41367598 |
T |
|
| Q |
315 |
ctctatatttagttttgaaagttcaatggtggtaaaaaatgatactacctccgtctttattataagagacaactcacttt |
394 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41367599 |
ctctatatttagttttgaaagttcaatggtggtaaaaaatgatactacctccgtctttattataagagacaactcacttt |
41367678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 371 - 420
Target Start/End: Original strand, 41374239 - 41374288
Alignment:
| Q |
371 |
ttattataagagacaactcactttttaggctagttgaataattgatttat |
420 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41374239 |
ttattataagagacaactcactttttaggctagttgaataattgatttat |
41374288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University