View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4014_low_18 (Length: 383)
Name: NF4014_low_18
Description: NF4014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4014_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 121; Significance: 7e-62; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 121; E-Value: 7e-62
Query Start/End: Original strand, 199 - 373
Target Start/End: Complemental strand, 52067810 - 52067636
Alignment:
| Q |
199 |
tttattttactaaatgttatttatttttcaaaatgtttagatggaaagaaggaacatgaatggctactcaannnnnnnnnnnnnnnnnnaccataaatga |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
52067810 |
tttattttactaaatgttatttatttttcaaaatgtttagatggaaagaaggaacatgaatggctactcaattttttatttttatttttaccataaatga |
52067711 |
T |
 |
| Q |
299 |
atgtggccaacctatgcaaaacaagccgtcactgccgtcctccggccactggtctctatctagccctgccctatg |
373 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52067710 |
atgtggccaacctatgcaaaacaagccgtcactgccgtcctccggccactggtctctatctagccctgccctatg |
52067636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 17 - 129
Target Start/End: Complemental strand, 52067992 - 52067880
Alignment:
| Q |
17 |
gtccataacaaatagaaaatttgttacttttcgagagatcatttggttgtaaggtcgattttcatctttgtaatcctcgtttcaatacttgaaattttct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52067992 |
gtccataacaaatagaaaatttgttacttttcgagagatcatttggttgtaaggtcgattttcatctttgtaatcctcgtttcaatacttgaaattttct |
52067893 |
T |
 |
| Q |
117 |
tttataattgacc |
129 |
Q |
| |
|
||||||||||||| |
|
|
| T |
52067892 |
tttataattgacc |
52067880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University