View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4014_low_35 (Length: 311)
Name: NF4014_low_35
Description: NF4014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4014_low_35 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 293
Target Start/End: Original strand, 30918882 - 30919183
Alignment:
| Q |
1 |
aaaactttaccgacactattagggtttttaatattgaatgagggattgttaagataatagcactactcccttcgaacgcggagatttgtttttcaaatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30918882 |
aaaactttaccgacactattagggtttttaatattgaatgggggattgttaagataatagcactactcccttcgaacgcggagatttgtttttcaaatat |
30918981 |
T |
 |
| Q |
101 |
gtcggtggcgtgtgggagttaaaagagaaattgaaacaaagttgcttcggctagatgaataactcgaacttgtannnnnnnncaatacaattatcttttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30918982 |
gtcggtggcgtgtgggagttaaaagagaaattgaaacaaagttgcttcggctagatgaataactcgaacttgtattttttttcaatacaattatcttttt |
30919081 |
T |
 |
| Q |
201 |
gagaaatttattccggaaaattatatagaaaagtcggttttccgtggcga---------aagcgattctcatagctcgacctccattatggttcacgtga |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| | |||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
30919082 |
gagaaatttattccggaaaattatatagaaaagccggttttccgtggcaatgttagtagaagcaattctcatagctcgacctccattatggttcacgtga |
30919181 |
T |
 |
| Q |
292 |
at |
293 |
Q |
| |
|
|| |
|
|
| T |
30919182 |
at |
30919183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University