View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4014_low_39 (Length: 304)
Name: NF4014_low_39
Description: NF4014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4014_low_39 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 1 - 295
Target Start/End: Complemental strand, 37546857 - 37546566
Alignment:
| Q |
1 |
agagatacagagataggggacatcattgccttactccgcccgcgagaagggctgaaatattatttttgacgcattaaaaagcaaactcatatgggaagta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37546857 |
agagatacagagataggggacatcattgccttactccgcccgcgagaagggctgaaatattatttttgacgcattaaaaagcaaactcatatgggaagta |
37546758 |
T |
 |
| Q |
101 |
gatatacaagccttcaaaatctcaatataatcacctattatcaccaaactcagcctcatgctaagtgtctaatagaaaacccaccttactcgatcatagt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| | || |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37546757 |
gatatacaagccttcaaaatctcaatatagtagg---ttttcaccaaactcagcctcatgctgagtgtctaatagaaaacccaccttactcgatcatagt |
37546661 |
T |
 |
| Q |
201 |
aggttttctctatatccactttgatagcaacatacctctttgataacccacaaatatgttcgttaatacctttacttttttccctaaatattctt |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37546660 |
aggttttctctatatccactttgatagcaacatacctctttgataacccacaaatatgttggttaatacctttacttttttccctaaatattctt |
37546566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University