View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4014_low_50 (Length: 270)
Name: NF4014_low_50
Description: NF4014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4014_low_50 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 16 - 250
Target Start/End: Complemental strand, 52000852 - 52000621
Alignment:
| Q |
16 |
cagagatggtgtatacaaaggaggtaatattggtatggaggaagtagccattcgtattgggagattaaatatttttgcgtggatgccttggcgaatttgg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52000852 |
cagagatggtgtatacaaaggaggtaatattggtatggaggaagtagccattcgtattgggagattaaatatttttgcgtggatgccttggcgaatttgg |
52000753 |
T |
|
| Q |
116 |
gttgtgaagctgattttcccttatgtatgcttctcaaattagtagtagttttctttcagctgatttagttggtttttcaactatgtggtttgttaaacgg |
215 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52000752 |
gttgtgaagctgattttcccttgtgtatgcttctcaaattag---tagttttctttcagctgatttagttggtttttcaactatgtggtttgttaaacgg |
52000656 |
T |
|
| Q |
216 |
ttttgcttttacgggcttaggcgctcttgttatcc |
250 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||| |
|
|
| T |
52000655 |
ttttgctcttacggacttaggcgctcttgttatcc |
52000621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University