View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4014_low_65 (Length: 243)
Name: NF4014_low_65
Description: NF4014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4014_low_65 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 37347774 - 37347549
Alignment:
| Q |
1 |
aaactatgaagggaagttgattgtcaaattaaaaagtcaaagtcaaaactacttccatgtggttttaacttgtttttaggatgaagatgtgttttcaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37347774 |
aaactatgaagggaagttgattgtgaaattaaaaaatcaaagtcaaaactacttccatgtggttttaacttgtttttaggatgaagatgtgttttcaatt |
37347675 |
T |
|
| Q |
101 |
cttaaacaggaggcgtgtcatcttgacatacacgttatttcatcttactggaaaattctatgtacacacattaaataatatttatatacaaatgtctaaa |
200 |
Q |
| |
|
|||||||||| ||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37347674 |
cttaaacaggtggcgtgtcatcttgatatacgcgttatttcatcttactggaaaattctatgtacacacattaaataatatttatatacaaatgtctaaa |
37347575 |
T |
|
| Q |
201 |
atgttaacccgtcaaatagattcttatgt |
229 |
Q |
| |
|
||||||| ||||||||||||||||||| |
|
|
| T |
37347574 |
atgttaa---gtcaaatagattcttatgt |
37347549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University