View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4014_low_7 (Length: 551)
Name: NF4014_low_7
Description: NF4014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4014_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 95; Significance: 3e-46; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 434 - 536
Target Start/End: Original strand, 5216617 - 5216719
Alignment:
| Q |
434 |
tacctcaacatgtcaagcaggctccctatatattcatgcatatacttcacccttgtccagtcatctgatgatgaattccttcgtgtttgttgacctgaga |
533 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
5216617 |
tacctcaacatgtcaagcaggctccctatatattcatgcatatacttcacccttgtccagtcatctaatgatgaattcctacgtgtttgttgacctgaga |
5216716 |
T |
 |
| Q |
534 |
agt |
536 |
Q |
| |
|
||| |
|
|
| T |
5216717 |
agt |
5216719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University