View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4014_low_75 (Length: 238)
Name: NF4014_low_75
Description: NF4014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4014_low_75 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 125 - 236
Target Start/End: Complemental strand, 14179537 - 14179427
Alignment:
| Q |
125 |
aattcacaaaaacaagtataacattttggttgaagaaatactctaaacaccaaagttaaataacaacacaagcaattacaaaatgtttccacaaactctc |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
14179537 |
aattcacaaaaacaagtataacattttggttgaagaaattctctaaacaccaaagttaaataacaacacaagcaattac-aaatgtttccacaacctctc |
14179439 |
T |
 |
| Q |
225 |
aattttgacctt |
236 |
Q |
| |
|
|||||||||||| |
|
|
| T |
14179438 |
aattttgacctt |
14179427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University