View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4014_low_79 (Length: 227)
Name: NF4014_low_79
Description: NF4014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4014_low_79 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 6 - 223
Target Start/End: Original strand, 32710393 - 32710610
Alignment:
| Q |
6 |
acaaccatttttgtttatatatcgagggagtattaattgttatcttatgaatttaaccgcaatcatactaagaaaacaatcaactacgattttgagctta |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32710393 |
acaaccatttttgtttatatatcgagggagtattaattgttatcttatgaatttaaccgcaatcatactaagaaaacaatcaactacgattttgagctta |
32710492 |
T |
|
| Q |
106 |
tgtagtcatgattaaccatctaaattattttcaaatttacgttattttttcaggtgttaaaatattcacgacttttacttgaaaaatatggttaataacg |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
32710493 |
tgtagtcatgattaaccatctaaattatttttaaatttacgttattttttcaggtgttaaaatattcacgacttttacttgaaaaatatggttaataaag |
32710592 |
T |
|
| Q |
206 |
ttcaaaattatggttaac |
223 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
32710593 |
ttcaaaattatggttaac |
32710610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 187 - 222
Target Start/End: Complemental strand, 26371890 - 26371855
Alignment:
| Q |
187 |
aaaaatatggttaataacgttcaaaattatggttaa |
222 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |
|
|
| T |
26371890 |
aaaattatggttaataacgttcaaaattatggttaa |
26371855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University