View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4014_low_82 (Length: 223)
Name: NF4014_low_82
Description: NF4014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4014_low_82 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 15 - 207
Target Start/End: Original strand, 33275579 - 33275759
Alignment:
| Q |
15 |
cacagaaaactaatgacacaattaatgaagcagagtgaaggaactcaatagaaaaaacacctatcccttcgaattaaaccccaaatctcatactatccta |
114 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| |||||| |||| |||| |||||||||||||||| |||||||||| |
|
|
| T |
33275579 |
cacagaaaacaaatgacacaattaatgaagcagagtgaaggaacacaataggaaaa-caccg-----------ttaaaccccaaatctcttactatccta |
33275666 |
T |
|
| Q |
115 |
tcttgttcattacacatcacactcacctcattggtggaaactgtccttatctcaccttgcccaacctcttgcctcccttttgttcccactttc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33275667 |
tcttgttcattacacatcacactcacctcattggtggaaactgtccttatctcaccttgcccaacctcttgcctcccttttgttcccactttc |
33275759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 18 - 107
Target Start/End: Original strand, 33274462 - 33274550
Alignment:
| Q |
18 |
agaaaactaatgacacaattaatgaagcagagtgaaggaactcaatagaaaaaacacctatcccttcgaattaaaccccaaatctcatac |
107 |
Q |
| |
|
||||||| ||||||||||| |||||| || ||||||||| || |||||||| ||||| |||||||||||||||||||||||| |||| |
|
|
| T |
33274462 |
agaaaacaaatgacacaatcaatgaatcatggtgaaggaatgcagtagaaaaa-cacctggcccttcgaattaaaccccaaatctaatac |
33274550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University