View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4014_low_84 (Length: 210)

Name: NF4014_low_84
Description: NF4014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4014_low_84
NF4014_low_84
[»] chr3 (1 HSPs)
chr3 (16-193)||(52000678-52000852)


Alignment Details
Target: chr3 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 16 - 193
Target Start/End: Complemental strand, 52000852 - 52000678
Alignment:
16 cagagatggtgtatacaaaggaggtaatattggtatggaggaagtagccattcgtattgggagattaaatatttttgcgtggatgccttggcgaatttgg 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52000852 cagagatggtgtatacaaaggaggtaatattggtatggaggaagtagccattcgtattgggagattaaatatttttgcgtggatgccttggcgaatttgg 52000753  T
116 gttgtgaagctgattttcccttatgtatgcttctcaaattagtagtagttttctttcagctgatttagttggtttttc 193  Q
    |||||||||||||||||||||| |||||||||||||||||||   |||||||||||||||||||||||||||||||||    
52000752 gttgtgaagctgattttcccttgtgtatgcttctcaaattag---tagttttctttcagctgatttagttggtttttc 52000678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University