View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4015_high_14 (Length: 315)
Name: NF4015_high_14
Description: NF4015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4015_high_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 6e-71; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 4 - 143
Target Start/End: Original strand, 6976602 - 6976741
Alignment:
| Q |
4 |
tcatatagattgtgctcaatattatggcaatgaaaaggaggtgaggtgttatgtatcattagtcctatcaatgtcaatatcgtgtctgatgtccgtgttt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6976602 |
tcatatagattgtgctcaatattatggcaatgaaaaggaggtgaggtgttatgtatcattagtcctatcaatgtcaatatcgtgtctgatgtccgtgttt |
6976701 |
T |
|
| Q |
104 |
gtgtccatgcttcatagaatacatctgtccatcatctttt |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
6976702 |
gtgtccatgcttcatagaatacatctgtccatcatgtttt |
6976741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 187 - 302
Target Start/End: Original strand, 6976735 - 6976839
Alignment:
| Q |
187 |
atgttttagtaaagaaatattattcagtatgttgattgcagaatttgaatttgaaattgttacagttttgaattttgatactctttttgctgatacaccg |
286 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6976735 |
atgttttagtaaagaaatattattcagta-----------gaatttgaatttgaaattgttacagttttgaattttgatactctttttgctgatacaccg |
6976823 |
T |
|
| Q |
287 |
tcgtggtagtgtttat |
302 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
6976824 |
tcgtggtagtgtttat |
6976839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 45
Target Start/End: Original strand, 6957142 - 6957183
Alignment:
| Q |
4 |
tcatatagattgtgctcaatattatggcaatgaaaaggaggt |
45 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6957142 |
tcatatagattgtgctcaaatttatggcaatgaaaaggaggt |
6957183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 93 - 121
Target Start/End: Original strand, 6301467 - 6301495
Alignment:
| Q |
93 |
tgtccgtgtttgtgtccatgcttcataga |
121 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6301467 |
tgtccgtgtttgtgtccatgcttcataga |
6301495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University