View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4015_high_16 (Length: 273)
Name: NF4015_high_16
Description: NF4015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4015_high_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 12 - 239
Target Start/End: Original strand, 31657068 - 31657293
Alignment:
| Q |
12 |
atgaaatagagttttgctctgtagcataagccattgattcaacaaaataaaaaggtttttctatcataacaatcagagctttccttctaggtgttggctc |
111 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||| |||| |||||| ||||||| |||||||||| | ||||||||||||||||||| |
|
|
| T |
31657068 |
atgaaataga-ttttgctctgtagcataagccattgattcaacaaaa-aaaagggttttgctatcatgacaatcagagatctccttctaggtgttggctc |
31657165 |
T |
 |
| Q |
112 |
gctttgttcgaaaccaaaactcactgctnnnnnnngatataaaaagagtagcaaaaatgttgaaggaggtttacggtgttcctgaagcaaacattacggt |
211 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||| |||||||||||||||||||||||||||| ||||| ||| ||| | |||||||||||| || |
|
|
| T |
31657166 |
gctttgttcgaaaccaaaactcgctgctaaaaaaagatgtaaaaagagtagcaaaaatgttgaaggaagtttatggttttcgtaaagcaaacattatagt |
31657265 |
T |
 |
| Q |
212 |
gatactagattcaattgcaaatgtgaca |
239 |
Q |
| |
|
||| ||||||||||||| |||||||||| |
|
|
| T |
31657266 |
gatgctagattcaattgtaaatgtgaca |
31657293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University