View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4015_high_17 (Length: 257)
Name: NF4015_high_17
Description: NF4015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4015_high_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 165 - 205
Target Start/End: Complemental strand, 25413177 - 25413137
Alignment:
| Q |
165 |
ttttaatatgaattcatcaaaaataggtttagaatattatt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25413177 |
ttttaatatgaattcatcaaaaataggtttagaatattatt |
25413137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 205
Target Start/End: Complemental strand, 23124575 - 23124536
Alignment:
| Q |
166 |
tttaatatgaattcatcaaaaataggtttagaatattatt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
23124575 |
tttaatatgaattcatcaaaaataggtttagaatgttatt |
23124536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University