View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4015_high_27 (Length: 217)
Name: NF4015_high_27
Description: NF4015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4015_high_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 16 - 198
Target Start/End: Complemental strand, 24309577 - 24309395
Alignment:
| Q |
16 |
aatatgaagtttaggacaagtattattttgtctcacaaagtattccttgtgctttgtagggtatgattttaatnnnnnnnttatttgctctttcnnnnnn |
115 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
24309577 |
aatatgaagtttaggactagtattattttgtctcacaaagtattccttgtgctttgtagggtatgattttaataaaaaaattatttgctctttcaaaaaa |
24309478 |
T |
 |
| Q |
116 |
nnttatccaaattatccttgcatatagcatgtcagtgaatcaattgatgatggtcaattattccttgcatgttcagtgttagt |
198 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24309477 |
aattatccaaattttccttgcatatagcatgtcagtgaatcaattgatgatggtcaattattccttgcatgttcagtgttagt |
24309395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University