View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4015_high_28 (Length: 215)
Name: NF4015_high_28
Description: NF4015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4015_high_28 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 19 - 202
Target Start/End: Complemental strand, 5329159 - 5328976
Alignment:
| Q |
19 |
aagaacaagagaaacaaaagaaacaacaaacggtagttggttgagtagagcatggcagagtctgctgtgttgtggttattgagcaaagnnnnnnngacaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5329159 |
aagaacaagagaaacaaaagaaacaacaaacggtagttggttgagtagagcatggcagagtctgctgtgttgtggttattgagcaaagaaaaaaagacaa |
5329060 |
T |
|
| Q |
119 |
catttggttttgtctaaaaataaaaatggtgacaactttttgaggaagggaatttacgtgtaactcattgagcaaggtaagaat |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5329059 |
catttggttttgtctaaaaataaaaatggtgacaactttttgaggaagggaatttacgtgtaactcattgagcaaggtaagaat |
5328976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University