View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4015_high_31 (Length: 203)
Name: NF4015_high_31
Description: NF4015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4015_high_31 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 14 - 188
Target Start/End: Complemental strand, 17789173 - 17788999
Alignment:
| Q |
14 |
caaagggggtggctacataaaaacataaattggtaactgtcaggtcaaacagaaaccttaagatacaagcaaccactaggaattagatatccaacggttt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17789173 |
caaagggggtggctacataaaaacataaattggtaactgtcacgtcaaacagaaaccttaagatacaagcaaccactaggaattagatatccaacggttt |
17789074 |
T |
|
| Q |
114 |
tgatgacggcagttggttggtcggtgccggtgattcatccagtttcacttctggcttgcctacaccatgttagtg |
188 |
Q |
| |
|
|| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17789073 |
tggtgacggcagttggttggtcggtgcaggtgattcatccagtttcacttctggcttgcctacaccatgttagtg |
17788999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University