View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4015_low_18 (Length: 257)

Name: NF4015_low_18
Description: NF4015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4015_low_18
NF4015_low_18
[»] chr5 (2 HSPs)
chr5 (165-205)||(25413137-25413177)
chr5 (166-205)||(23124536-23124575)


Alignment Details
Target: chr5 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 165 - 205
Target Start/End: Complemental strand, 25413177 - 25413137
Alignment:
165 ttttaatatgaattcatcaaaaataggtttagaatattatt 205  Q
    |||||||||||||||||||||||||||||||||||||||||    
25413177 ttttaatatgaattcatcaaaaataggtttagaatattatt 25413137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 205
Target Start/End: Complemental strand, 23124575 - 23124536
Alignment:
166 tttaatatgaattcatcaaaaataggtttagaatattatt 205  Q
    |||||||||||||||||||||||||||||||||| |||||    
23124575 tttaatatgaattcatcaaaaataggtttagaatgttatt 23124536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University