View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4015_low_27 (Length: 235)
Name: NF4015_low_27
Description: NF4015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4015_low_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 112; Significance: 9e-57; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 9102705 - 9102590
Alignment:
| Q |
1 |
ccctattcttaagcatgtgcaattggcaaatcttaatgttgaatctcactgcaaaaggccagccctaaaaagttttgagcacaaggaaattattgctcta |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9102705 |
ccctattcttaagcatgtgcaattggcgaatcttaatgttgaatctcactgcaaaaggccagccctaaaaagttttgagcacaaggaaattattgctcta |
9102606 |
T |
 |
| Q |
101 |
aatgtgtaacatccca |
116 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
9102605 |
aatgtgtaacatccca |
9102590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University