View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4015_low_27 (Length: 235)

Name: NF4015_low_27
Description: NF4015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4015_low_27
NF4015_low_27
[»] chr7 (1 HSPs)
chr7 (1-116)||(9102590-9102705)


Alignment Details
Target: chr7 (Bit Score: 112; Significance: 9e-57; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 9102705 - 9102590
Alignment:
1 ccctattcttaagcatgtgcaattggcaaatcttaatgttgaatctcactgcaaaaggccagccctaaaaagttttgagcacaaggaaattattgctcta 100  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9102705 ccctattcttaagcatgtgcaattggcgaatcttaatgttgaatctcactgcaaaaggccagccctaaaaagttttgagcacaaggaaattattgctcta 9102606  T
101 aatgtgtaacatccca 116  Q
    ||||||||||||||||    
9102605 aatgtgtaacatccca 9102590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University