View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4016_high_2 (Length: 519)
Name: NF4016_high_2
Description: NF4016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4016_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 244; Significance: 1e-135; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 142 - 494
Target Start/End: Original strand, 5110452 - 5110800
Alignment:
| Q |
142 |
aagtaaaagttgaatctatcccactcacttaaattagtttattaatttttagaagttttttagtttcttnnnnnnnnnnntgagaagctagttgattgtc |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
5110452 |
aagtaaaagttgaatctatcccactcacttaaattagtttattaatttttagaagttttttagtttcttaaaaaaaatt----gaagctagttcattgtc |
5110547 |
T |
 |
| Q |
242 |
atctctaattcttgagatggtctatttccacccatatccatggggtaaagaatttttcaaaccatggtgaacacttcatatgaagtttattcatttgttt |
341 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5110548 |
atctctaattcttgagatgacctatttccacccatatccatggggtaaagaatttttcaaaccatggtgaacacttcatatgaagtttattcatttgttt |
5110647 |
T |
 |
| Q |
342 |
cttatgatctcattgtggagaaaatcagtcaccacaaccctttttatttctgctccttggtcggatgcgaagcnnnnnnnnnnnnnngctgatacatgtg |
441 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
5110648 |
cttatgatctcattgtggagaaaatcagtcaccacaaccctttttatttctgctccttggtcggatgcgaagcttttttatttttttgctgatacatgtg |
5110747 |
T |
 |
| Q |
442 |
aagcttattttaaatgtgtttctaagaaatattataaaagctcattcttgcta |
494 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
5110748 |
aagcttattttaaatgtgtttctaagaaatattattaaagctcatttttgcta |
5110800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 18 - 100
Target Start/End: Original strand, 5110328 - 5110410
Alignment:
| Q |
18 |
catttttctcgtgttctggcattcataataattttttcataatccctttgatttttgctggttaatatgctacttaccccaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5110328 |
catttttctcgtgttctggcattcataatagttttttcataatccctttgatttttgctggttaatatgctacttaccccaaa |
5110410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University