View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4016_high_21 (Length: 256)
Name: NF4016_high_21
Description: NF4016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4016_high_21 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 36 - 256
Target Start/End: Original strand, 50212530 - 50212750
Alignment:
| Q |
36 |
gctacaaaacactaacacattagattgaagatgtattatttgttgtccaacatgcgtcaaactatgaaacaacatatcacggnnnnnnntactatggcac |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
50212530 |
gctacaaaacactaacacattagattgaagatgtattatttgttgtccaacatgcgtcaaactatgaaacaacatatcacggaaaaaaatactatggcac |
50212629 |
T |
 |
| Q |
136 |
aacgctgacaaatgtaacattcaggctcagttcagcaaggtcaaaccgctagcttagtgtacaagtttgtactataaaagtatagtattttttgacacac |
235 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
50212630 |
aacgctgacaaatgttacattcaggctcagttcagcaaggtcaaaccgatagcttagtgtacaagtttgtactataaaagtatagtattttttgatacac |
50212729 |
T |
 |
| Q |
236 |
tacttagagcagagttttaac |
256 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
50212730 |
tacttagagcagagttttaac |
50212750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University