View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4016_high_32 (Length: 227)

Name: NF4016_high_32
Description: NF4016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4016_high_32
NF4016_high_32
[»] chr3 (1 HSPs)
chr3 (1-212)||(46899051-46899262)


Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 46899051 - 46899262
Alignment:
1 acaatctatttcaccaataacaactctacaccattaatgttccaacaacaacaaacaacaccgttaatgttttcgaattcgagcaacgagattgctccga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46899051 acaatctatttcaccaataacaactctacaccattaatgttccaacaacaacaaacaacaccgttaatgttttcgaattcgagcaacgagattgctccga 46899150  T
101 atacgaaccattatggtactgcgtcgccatcagagaaacgaaactcgatggcggcgatgagggagatgatattcagaatagcagctatgcaaccaattta 200  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46899151 atacgaaccattatggtactgcatcgccatcagagaaacgaaactcgatggcggcgatgagggagatgatattcagaatagcagctatgcaaccaattta 46899250  T
201 catagaccctga 212  Q
    ||||||||||||    
46899251 catagaccctga 46899262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University