View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4016_low_31 (Length: 234)
Name: NF4016_low_31
Description: NF4016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4016_low_31 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 11 - 214
Target Start/End: Original strand, 33941401 - 33941615
Alignment:
| Q |
11 |
ttatactcacaaagacaaattcctataattttaaacacgcgccaagtaaaccaattgattcagtttaagtgaactttgattaaatgcgaatcattagcta |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| |||||||||||||| |||||||| |||| |
|
|
| T |
33941401 |
ttatactcacaaagacaaattcctataattttaaacacgcgccaaataaaccaattgattcggtttaagtaaactttgattaaatatgaatcattcgcta |
33941500 |
T |
 |
| Q |
111 |
gaatctaaaacaactatagttcaaattttacttag------------cttaaacacctcaatcttccttcaagggtaaagacaaaagaacatgcacttaa |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33941501 |
gaatctaaaacaactatagttcaaattttacttagcttcgaccgaaccttaaacacctcaatcttccttcaagggtaaagacaaaagaacatgcacttaa |
33941600 |
T |
 |
| Q |
199 |
tagagtagtaaatttt |
214 |
Q |
| |
|
||| |||||||||||| |
|
|
| T |
33941601 |
tag-gtagtaaatttt |
33941615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University