View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4017-Insertion-19 (Length: 289)
Name: NF4017-Insertion-19
Description: NF4017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4017-Insertion-19 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 7 - 289
Target Start/End: Original strand, 39578673 - 39578955
Alignment:
| Q |
7 |
actttgtgtccccaaacttttcttatgagcagaggttgaaggttttcctatatacgcatctataggtggcttcattaattcatccttatggtttaagttt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39578673 |
actttgtgtccccaaacttttcttatgagcagaggttgaaggttctcctatatacgcatctataggtggcttcattaattcatccttatggtttaagttt |
39578772 |
T |
 |
| Q |
107 |
ggaggttgaggctcatttttatcatcatcatcatataatttcttgatagttcttagcatccatgccaaggtagagttctcatctagtggttttcctttta |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
39578773 |
ggaggttgaggctcatttttatcatcatcatcatataatttcttgatagttcttagcatccatgccaagttagagttttcatctagtggttttcctttta |
39578872 |
T |
 |
| Q |
207 |
atgcatccttaacctcgtttgacatctgcctcaaagacgccattcgatcttgtaatttgtctttaatggcattgtcttccaca |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39578873 |
atgcatccttaacctcgtttgacatctgcctcaaagacgccattcgatcttgtaatttgtctttaatggcattgtcttccaca |
39578955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University